R Programming for Biologists

Teaching the tools to get computers to do cool science

Creative Commons License

Programming Fundamentals 2

Assignment

Learning Objectives

Following this assignment students should be able to:

  • practice basic syntax and usage of for loops
  • use for loops to automate function operations
  • understand how to decompose complex problems

Reading

Lecture Notes

Loops

Exercises

  1. Use and Modify with Apply (15 pts)

    This is a followup to Use and Modify.

    1. Write a function that takes length as an argument to get an estimate of mass values for the dinosaur Theropoda. Use the equation mass <- 0.73 * length ** 3.63, where 0.73 is a and 3.63 is b. Then use sapply() and the following vector of lengths to get a vector of estimated masses.

      theropoda_lengths <- c(17.8013631070471, 20.3764452071665, 14.0743486294308, 25.65782386974, 26.0952008049675, 20.3111541103134, 17.5663244372533, 11.2563431277577, 20.081903202614, 18.6071626441984, 18.0991894513166, 23.0659685685892, 20.5798853467837, 25.6179254233558, 24.3714331573996, 26.2847248252537, 25.4753783544473, 20.4642089867304, 16.0738256364701, 20.3494171706583, 19.854399305869, 17.7889814608919, 14.8016421998303, 19.6840911485379, 19.4685885050906, 24.4807784966691, 13.3359960054899, 21.5065994598917, 18.4640304608411, 19.5861532398676, 27.084751999756, 18.9609366301798, 22.4829168046521, 11.7325716149514, 18.3758846100456, 15.537504851634, 13.4848751773738, 7.68561192214935, 25.5963348603783, 16.588285389794)

    2. Rewrite the function with a and b as arguments, then use mapply() to determine the mass estimates for the dinosaurs using the following vectors of a and b values for each dinosaur.

      a_values <- c(0.759, 0.751, 0.74, 0.746, 0.759, 0.751, 0.749, 0.751, 0.738, 0.768, 0.736, 0.749, 0.746, 0.744, 0.749, 0.751, 0.744, 0.754, 0.774, 0.751, 0.763, 0.749, 0.741, 0.754, 0.746, 0.755, 0.764, 0.758, 0.76, 0.748, 0.745, 0.756, 0.739, 0.733, 0.757, 0.747, 0.741, 0.752, 0.752, 0.748)

      b_values <- c(3.627, 3.633, 3.626, 3.633, 3.627, 3.629, 3.632, 3.628, 3.633, 3.627, 3.621, 3.63, 3.631, 3.632, 3.628, 3.626, 3.639, 3.626, 3.635, 3.629, 3.642, 3.632, 3.633, 3.629, 3.62, 3.619, 3.638, 3.627, 3.621, 3.628, 3.628, 3.635, 3.624, 3.621, 3.621, 3.632, 3.627, 3.624, 3.634, 3.621)

  2. Crown Volume Calculation (15 pts)

    The UHURU experiment in Kenya has conducted a survey of Acacia and other tree species in ungulate exclosure treatments. Data for the tree data is available here in a tab delimited ("\t") format. Each of the individuals surveyed were measured for tree height (HEIGHT) and canopy size in two directions (AXIS_1 and AXIS_2). Read these data in using the following code:

    tree_data <- read.csv("http://www.esapubs.org/archive/ecol/E095/064/TREE_SURVEYS.txt",
                 sep = '\t',
                 na.strings = c("dead", "missing", "MISSING",
                                "NA", "?", "3.3."),
                 stringsAsFactors = FALSE)

    You want to estimate the crown volumes for the different species and have developed equations for species in the Acacia genus:

    volume = 0.16 * HEIGHT^0.8 * pi * AXIS_1 * AXIS_2

    and the Balanites genus:

    volume = 1.2 * HEIGHT^0.26 * pi * AXIS_1 * AXIS_2

    For all other genera you’ll use a general equation developed for trees:

    volume = 0.5 * HEIGHT^0.6 * pi * AXIS_1 * AXIS_2

    1. Write a function called tree_volume_calc that calculates the canopy volume for the Acacia species in the dataset. To do so, use an if statement in combination with the str_detect() function from the stringr R package. The code str_detect(SPECIES, "Acacia") will return TRUE if the string stored in this variable contains the word “Acacia” and FALSE if it does not. This function will have to take the following arguments as input: SPECIES, HEIGHT, AXIS_1, AXIS_2. Then run the following line:

      tree_volume_calc("Acacia_brevispica", 2.2, 3.5, 1.12)

    2. Expand this function to additionally calculate canopy volumes for other types of trees in this dataset by adding if/else statements and including the volume equations for the Balanites genus and other genera. Then run the following lines:

      tree_volume_calc("Balanites", 2.2, 3.5, 1.12) tree_volume_calc("Croton", 2.2, 3.5, 1.12)

    3. Now get the canopy volumes for all the trees in the tree_data dataframe and add them as a new column to the data frame. You can do this using tree_volume_calc() and either mapply() or using dplyr with rowwise and mutate.

  3. Use and Modify with Loops (15 pts)

    This is a followup to Use and Modify. It is a partner exercise to Use and Modify with Apply.

    1. Write a function that takes length as an argument to get an estimate of mass values for the dinosaur Theropoda (or copy the one you wrote as part of Use and Modify). Use the equation mass <- 0.73 * length ** 3.63, where 0.73 is a and 3.63 is b. Then use a for loop over the values of the following vector of lengths to print out the estimated masses for each length.

      theropoda_lengths <- c(17.8013631070471, 20.3764452071665, 14.0743486294308, 25.65782386974, 26.0952008049675, 20.3111541103134, 17.5663244372533, 11.2563431277577, 20.081903202614, 18.6071626441984, 18.0991894513166, 23.0659685685892, 20.5798853467837, 25.6179254233558, 24.3714331573996, 26.2847248252537, 25.4753783544473, 20.4642089867304, 16.0738256364701, 20.3494171706583, 19.854399305869, 17.7889814608919, 14.8016421998303, 19.6840911485379, 19.4685885050906, 24.4807784966691, 13.3359960054899, 21.5065994598917, 18.4640304608411, 19.5861532398676, 27.084751999756, 18.9609366301798, 22.4829168046521, 11.7325716149514, 18.3758846100456, 15.537504851634, 13.4848751773738, 7.68561192214935, 25.5963348603783, 16.588285389794)

    2. Write a new version of the function that takes a and b as arguments (or copy the one you wrote as part of Use and Modify), then use a for loop over an index to print the mass estimates for the dinosaurs using the following vectors of a and b values for each dinosaur.

      a_values <- c(0.759, 0.751, 0.74, 0.746, 0.759, 0.751, 0.749, 0.751, 0.738, 0.768, 0.736, 0.749, 0.746, 0.744, 0.749, 0.751, 0.744, 0.754, 0.774, 0.751, 0.763, 0.749, 0.741, 0.754, 0.746, 0.755, 0.764, 0.758, 0.76, 0.748, 0.745, 0.756, 0.739, 0.733, 0.757, 0.747, 0.741, 0.752, 0.752, 0.748)

      b_values <- c(3.627, 3.633, 3.626, 3.633, 3.627, 3.629, 3.632, 3.628, 3.633, 3.627, 3.621, 3.63, 3.631, 3.632, 3.628, 3.626, 3.639, 3.626, 3.635, 3.629, 3.642, 3.632, 3.633, 3.629, 3.62, 3.619, 3.638, 3.627, 3.621, 3.628, 3.628, 3.635, 3.624, 3.621, 3.621, 3.632, 3.627, 3.624, 3.634, 3.621)

    3. Write a new version of the loop from Task 2 that stores the resulting masses in a vector instead of printing them out. Once the loop is finished display the resulting vector.

  4. Multiple Files (20 pts)

    A colleague wants to do a comparitive analysis of the GC content (i.e., the percentage of bases in a DNA sequence that are either G or C) on data from the PATRIC bacterial phytogenomic database. They want to know the GC content of all of the bacteria in the database and have started working initially with a handful of archaea. They know a little R and wrote the following code to load a single sequence and caculate it’s GC content.

    library(ShortRead)
library(Biostrings)

reads <- readFasta("archaea-dna/A-saccharovorans.fasta")
seq <- sread(reads)
base_freq <- alphabetFrequency(seq)
gc_content <- (base_freq[1, "G"] + base_freq[1, "C"]) / sum(base_freq) * 100

    The first two lines load a .fasta file using the ShortRead package in Bioconductor. The second two lines determine the frequency of all of the bases in sequence and then calculate the GC content.

    Start by installing Bioconductor with the following code (this may take a while, so be patient):

    source("https://bioconductor.org/biocLite.R")
biocLite("ShortRead")
biocLite("Biostrings")

    Each fasta file contains one long sequence of DNA for an archaea species. The following code loads one sequence file, where seq is the variable name for the data file:

    library(ShortRead)
reads <- readFasta("archaea-dna/A-saccharovorans.fasta")
seq <- sread(reads)

    Help out your colleagues by downloading the data and looping over the files to determine the GC content for each file. Once downloaded, either unzip the .zip file manually or use the unzip function.

    Use list.files(), with full.names set to true, to generate a list of the names of all the sequence files. Then create a for loop that uses the above code to read in each sequence file and calculate it’s GC content. Store the resulting values in a data frame with one column with file names and a second column with GC contents.

  5. DNA or RNA Iteration (15 pts)

    This is a follow-up to DNA or RNA.

    Write a function, dna_or_rna(sequence), that determines if a sequence of base pairs is DNA, RNA, or if it is not possible to tell given the sequence provided. Since all the function will know about the material is the sequence the only way to tell the difference between DNA and RNA is that RNA has the base Uracil ("u") instead of the base Thymine ("t"). Have the function return one of three outputs: "DNA", "RNA", or "UNKNOWN".

    1. Use the function and a for loop to print the type of the sequences in the following list.
    2. Use the function and sapply to print the type of the sequences in the following list.
    sequences = c("ttgaatgccttacaactgatcattacacaggcggcatgaagcaaaaatatactgtgaaccaatgcaggcg", "gauuauuccccacaaagggagugggauuaggagcugcaucauuuacaagagcagaauguuucaaaugcau", "gaaagcaagaaaaggcaggcgaggaagggaagaagggggggaaacc", "guuuccuacaguauuugaugagaaugagaguuuacuccuggaagauaauauuagaauguuuacaacugcaccugaucagguggauaaggaagaugaagacu", "gauaaggaagaugaagacuuucaggaaucuaauaaaaugcacuccaugaauggauucauguaugggaaucagccggguc")

    Optional: For a little extra challenge make your function work with both upper and lower case letters, or even strings with mixed capitalization

  6. Climate Space Iteration (20 pts)

    This is a follow up to Climate Space Rewrite.

    Using the functions you created in Climate Space Rewrite iterate over the following list of species to create one plot per species from the list. Include a title for each plot that is the species name using the ggtitle() function. You can use any type of automated iteration that we’ve learned.

    species <- c("Juniperus occidentalis", "Quercus alba", "Picea glauca", "Ceiba pentandra", "Quercus rubra", "Larrea tridentata", "Opuntia pusilla")