R Programming for Biologists

Teaching the tools to get computers to do cool science

Creative Commons License

Strings

stringr Functions


Use the character functions from the package stringr to print the following strings.

  1. "atgcatgcatgcatgcatgcatgcatgcatgcatgcatgcatgcatgcatgcatgcatgc". Do this by duplicating “atgc” 15 times.
  2. " Thank goodness it's Friday" without the leading white space (i.e., without the spaces before "Thank").
  3. "gcagtctgaggattccaccttctacctgggagagaggacatactatatcgcagcagtggaggtggaatgg" with all of the occurences of "a" replaced with "A".
  4. Print the length of this dna sequence "gccgatgtacatggaatatacttttcaggaaacacatatctgtggagagg".
  5. The number of "a"s in "gccgatgtacatggaatatacttttcaggaaacacatatctgtggagagg".
  6. Print the first 20 positions of this dna sequence "gccgatgtacatggaatatacttttcaggaaacacatatctgtggagagg".
  7. Print the last 10 positions of this dna sequence "gccgatgtacatggaatatacttttcaggaaacacatatctgtggagagg".